¡@
python Programming Glossary: statingNew Python Programmer Looking for Help to Avoid Recursion with tkinter http://stackoverflow.com/questions/10039485/new-python-programmer-looking-for-help-to-avoid-recursion-with-tkinter modules some people prefer importing like this clearly stating where everything comes from import tkinter as tk class Application..
Equivalent of NotImplementedError for fields in Python http://stackoverflow.com/questions/1151212/equivalent-of-notimplementederror-for-fields-in-python there an equivalent way to mark a field as abstract Or is stating it in the class docstring all you can do At first I thought..
Fast comparison between two Python dictionary http://stackoverflow.com/questions/1165352/fast-comparison-between-two-python-dictionary thoughts... Thanks for your responses. Apologies for not stating my question properly. My scenario is like this I have a dictA..
Error when Installing Pygame on Mountain Lion http://stackoverflow.com/questions/11954497/error-when-installing-pygame-on-mountain-lion line tools provided with Xcode 4.4 I get an error message stating the following src scale_mmx64.c 499 27 error invalid instruction..
OSX: error when installing python packages http://stackoverflow.com/questions/14720702/osx-error-when-installing-python-packages would very much appreciate a spoon fed solution explicitly stating what I have to do in the Terminal to fix this . I am not very..
Pickling a staticmethod in Python http://stackoverflow.com/questions/1914261/pickling-a-staticmethod-in-python methods. Pickle fails for example on module.MyClass.foo stating it cannot be pickled as module.foo does not exist. I have come..
How do I get my simple twisted proxy to work? http://stackoverflow.com/questions/2269380/how-do-i-get-my-simple-twisted-proxy-to-work it is implied that this is not a leaf node however you are stating that it is a leaf node by setting isLeaf True . How can a leaf..
Parsing broken XML with lxml.etree.iterparse http://stackoverflow.com/questions/2352840/parsing-broken-xml-with-lxml-etree-iterparse a short introduction in which we identified ourselves stating our voice part and a little about our livelihood we began our..
How to stop attributes from being pickled in Python http://stackoverflow.com/questions/2999638/how-to-stop-attributes-from-being-pickled-in-python when I do dump the object to a string I get an exception stating that the pickler encountered an unpickleable type thread.lock..
GetWindowRect too small on Windows 7 http://stackoverflow.com/questions/3192232/getwindowrect-too-small-on-windows-7 of investigation turns up this . It's a thread from 2006 stating that you might not get the correct values from GetWindowsRect..
Attaching a decorator to all functions within a class http://stackoverflow.com/questions/3467526/attaching-a-decorator-to-all-functions-within-a-class within a class generically rather than explicitly stating it for every function. I suppose it then becomes a kind of aspect..
Create constants in Python using a “settings” module http://stackoverflow.com/questions/3824455/create-constants-in-python-using-a-settings-module do some more coding return var I am getting a Python error stating global name 'CONSTANT' is not defined. I have noticed on Django's..
Installing specific package versions with Pip http://stackoverflow.com/questions/5226311/installing-specific-package-versions-with-pip a way to install the older version I found an article stating that this should do it pip install MySQL_python 1.2.2 When installed..
Should we use Epydoc, Sphinx or something else for documenting Python APIs? http://stackoverflow.com/questions/5579198/should-we-use-epydoc-sphinx-or-something-else-for-documenting-python-apis remember seeing a note on the Sphinx project pages earlier stating that it isn't an API documentation tool and that Epydoc should..
If monkey patching is permitted in both Ruby and Python, why is it more controversial in Ruby? http://stackoverflow.com/questions/717506/if-monkey-patching-is-permitted-in-both-ruby-and-python-why-is-it-more-controve become popular. C and Java programmers would ˜bash Python stating that it wasn't a real language and that the dynamic nature of..
parsing a fasta file using a generator ( python ) http://stackoverflow.com/questions/7654971/parsing-a-fasta-file-using-a-generator-python ACATTTCCCTATACTGGAGACCCTCC each entry starts with a stating the name etc then the next N lines are data. There is no defined..
Finding the source code for built-in Python functions? [duplicate] http://stackoverflow.com/questions/8608587/finding-the-source-code-for-built-in-python-functions and inspect.getsource will return a type error stating that the object is built in. However many of the built in types..
How do I run long term (infinite) Python processes? http://stackoverflow.com/questions/8685695/how-do-i-run-long-term-infinite-python-processes infinite loop share improve this question I'll open by stating that this is one way to manage a long running process LRP not..
urllib2 HTTPPasswordMgr not working - Credentials not sent error http://stackoverflow.com/questions/9495279/urllib2-httppasswordmgr-not-working-credentials-not-sent-error translate to urllib2. I receive a different XML response stating that the user did not supply authorization credentials import..
|