¡@
python Programming Glossary: outcomeWhy is if not someobj: better than if someobj == None: in Python? http://stackoverflow.com/questions/100732/why-is-if-not-someobj-better-than-if-someobj-none-in-python then converted to a bool value and used to determine the outcome of the if . Otherwise if the object has a __cmp__ method it..
How should I unit test a code-generator? http://stackoverflow.com/questions/11060/how-should-i-unit-test-a-code-generator it the wrong way. Maybe I need to focus more on the outcome IE does the code I generate actually run and do what I want..
Separation of business logic and data access in django http://stackoverflow.com/questions/12578908/separation-of-business-logic-and-data-access-in-django name in this context we do not have any control over the outcome because we rely on an external API. Making Queries The most..
Python subprocess.Popen “OSError: [Errno 12] Cannot allocate memory” http://stackoverflow.com/questions/1367373/python-subprocess-popen-oserror-errno-12-cannot-allocate-memory and overcommit configuration in order to influence the outcome of the enforcement. Now in order to actually move forward I'd..
How to find the overlap between 2 sequences, and return it http://stackoverflow.com/questions/14128763/how-to-find-the-overlap-between-2-sequences-and-return-it the left sequence and the s2 being the right one. The outcome should be ˜GGCTCCCCACGGGGTACCCATAACTTGACAGTAGATCTC Any help is..
“Large data” work flows using pandas http://stackoverflow.com/questions/14262433/large-data-work-flows-using-pandas every column look for interesting relationships with some outcome variable and create new compound columns that describe those.. that explain the relationship between my data and some outcome. At the very end of this process I apply some learning techniques..
How to vectorize this python code? http://stackoverflow.com/questions/14447442/how-to-vectorize-this-python-code 4 4 3 8 3 4 6 2 4 4 6 5 5 6 B algorithm A B 6 The expected outcome and what I get with the first code is 0 2 5 2 0 10 8 0 4 4 2..
Remove items from a list while iterating without using extra memory in Python http://stackoverflow.com/questions/2629198/remove-items-from-a-list-while-iterating-without-using-extra-memory-in-python check every element against a condition. Depending on the outcome of the condition I would like to delete the current element..
how to tell if a string is base64 or not http://stackoverflow.com/questions/271657/how-to-tell-if-a-string-is-base64-or-not . It still needs a little post processing to interpret the outcome of that function though import email.header x ' gb2312 B uLGxvmhlbrixsb5nLnhscw..
Randomly selecting lines from files http://stackoverflow.com/questions/3009832/randomly-selecting-lines-from-files .33 .67 2 3 1 Switch to line 3 The probability for each outcome Line 1 .5 .67 1 3 Line 2 .5 .67 1 3 Line 3 .5 .33 2 1 3 From..
How do I use gluLookAt properly? http://stackoverflow.com/questions/3380100/how-do-i-use-glulookat-properly combined with the rotation to give a completely different outcome as the documentation said would arise. What on earth is wrong..
String Comparison Technique Used by Python http://stackoverflow.com/questions/4806911/string-comparison-technique-used-by-python string comparison more specifically how it determines the outcome when a less than or greater than sign is used. For instance.. items are compared and if they differ this determines the outcome of the comparison if they are equal the next two items are compared..
Python string formatting: % vs. .format http://stackoverflow.com/questions/5082452/python-string-formatting-vs-format situations The following uses each method and has the same outcome so what is the difference # usr bin python sub1 python string..
Convert structured array to regular NumPy array http://stackoverflow.com/questions/5957380/convert-structured-array-to-regular-numpy-array But with the array I wanted to convert it gives a strange outcome data np.array 0.014793682843446732 0.006681123282760382 0.0..
http://stackoverflow.com/questions/9189172/python-string-replace rsc Harold_and_Kumar_Christmas.jpg X.replace C c Yet the outcome is still like this PC 01 C Katherina Applications PyPP Path..
Parsing HTTP User-Agent string http://stackoverflow.com/questions/927552/parsing-http-user-agent-string suggestion#1 i.e. write your own. And I am happy with the outcome. Please feel free to use modify send me patch etc. It's here..
|