¡@
python Programming Glossary: continuousHow do I concatenate files in Python? http://stackoverflow.com/questions/1001538/how-do-i-concatenate-files-in-python is easy... however I am not sure if that will cause a continuous play I think it might if the files are using the same bitrate..
TeamCity for Python/Django continuous integration http://stackoverflow.com/questions/1091465/teamcity-for-python-django-continuous-integration for Python Django continuous integration I've set up TeamCity on a Linux Ubuntu box and.. much of the success. How can I manage that python django continuous integration teamcity share improve this question Ok so there's..
Getting SciPy quantiles to match Stata xtile function http://stackoverflow.com/questions/11347539/getting-scipy-quantiles-to-match-stata-xtile-function calculates 'm' from 'alphap' and 'betap' scipy has a continuous range of types for lack of a better word . I admit that I do..
“Large data” work flows using pandas http://stackoverflow.com/questions/14262433/large-data-work-flows-using-pandas 1 000 to 2 000 fields on average of mixed data types continuous nominal and ordinal variables of both numeric and character..
Is it possible to map a discontiuous data on disk to an array with python? http://stackoverflow.com/questions/16515465/is-it-possible-to-map-a-discontiuous-data-on-disk-to-an-array-with-python saving memory. The data stored in fortran record is not continuous as it is divided by record markers. The record structure is..
Image segmentation based on edge pixel map http://stackoverflow.com/questions/18972932/image-segmentation-based-on-edge-pixel-map by the way for reference. And the original image And the continuous probability map python opencv image processing edge detection..
Identify groups of continuous numbers in a list http://stackoverflow.com/questions/2154249/identify-groups-of-continuous-numbers-in-a-list groups of continuous numbers in a list I'd like to identify groups of continuous.. numbers in a list I'd like to identify groups of continuous numbers in a list so that myfunc 2 3 4 5 12 13 14 15 16 17 20.. as individual numbers not ranges. python list range continuous share improve this question EDIT 2 To answer the OP new..
Search for string allowing for one mismatch in any location of the string http://stackoverflow.com/questions/2420412/search-for-string-allowing-for-one-mismatch-in-any-location-of-the-string AGCCTCCCATGATTGAACAGATCAT . The genome is formatted as a continuous string i.e. CATGGGAGGCTTGCGGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTTGCGGAGTGCGGAGCCTGAGCCTGAGGGCGGAGCCTGAGGTGGGAGGCTT...... they are only comparing sequences and not searching a continuous string Related post python string pattern matching string matching..
Dimension Reduction in Categorical Data with missing values http://stackoverflow.com/questions/2837850/dimension-reduction-in-categorical-data-with-missing-values have a regression model in which the dependent variable is continuous but ninety percent of the independent variables are categorical.. I am aware of several methods for dimension reduction for continuous variables I am not aware of a similar statical literature for.. and tend to use transcan and impute function heavily for continuous variables and use a variation of tree method to impute categorical..
Postgres - how to return rows with 0 count for missing data? http://stackoverflow.com/questions/346132/postgres-how-to-return-rows-with-0-count-for-missing-data . The problem is that some of the queries give results continuous over the required period as this one select to_char date_trunc..
http://stackoverflow.com/questions/3775912/fourier-space-filtering that it has all 0 phase. Usually such a signal will be continuous only in a circular fashion and when used as a filter will create..
How can I improve my paw detection? http://stackoverflow.com/questions/4087919/how-can-i-improve-my-paw-detection Blur the input data a bit to make sure the paws have a continuous footprint. It would be more efficient to just use a larger kernel..
python: how to send packets in multi thread and then the thread kill itself http://stackoverflow.com/questions/605013/python-how-to-send-packets-in-multi-thread-and-then-the-thread-kill-itself thread kill itself I have a question. I'd like to send a continuous streams of byte to some host for certain amount of time let's..
http://stackoverflow.com/questions/9389681/complete-suffix-array search across the suffix array and the result will be one continuous range of entries of the suffix array. However there are optimised..
|